• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The present invention discloses lnDel molecular markers closely linked to rice heading date 5 genes and application thereof, wherein a molecular marker IN2 has a forward primer sequence of SEQ ID NO. 2 and a reverse primer sequence of SEQ ID NO. 3; application of the lnDel molecular marker IN2 in genetic analysis and fine mapping of rice heading date genes; a molecular marker IN10 has a forward primer sequence of SEQ ID NO. 6 and a reverse primer sequence ofSEQ ID NO. 7; and application of the lnDel molecular marker IN10 in genetic analysis 10 and fine mapping of rice heading date genes.
    公开号:NL2026532A
    申请号:NL2026532
    申请日:2020-09-24
    公开日:2021-10-25
    发明作者:Xuan Ning；Yao Fangyin；Zhao Qianqian；Liu Xu；Zhang Hua
    申请人:Shandong Academy Of Agricultural Sciences Biotechnology Res Center；
    IPC主号:
    专利说明:

    InDel MOLECULAR MARKERS CLOSELY LINKED TO RICE HEADING DATE GENES AND
    APPLICATION THEREOF Technical Field The present invention relates to InDel molecular markers closely linked to rice heading date genes and application thereof, and in particular to InDel (insertion-deletion polymorphism) molecular markers and application thereof in genetic analysis and fine mapping of rice heading date genes, which belongs to the field of DNA molecular marker technology and molecular biology technology.
    Background An Insertion-Deletion (InDel) molecular marker is a molecular marker developed based on the insertion or deletion of a nucleotide segment of a homologous sequence in different individual genomes, i.e. with respect to one genotype, the genome of another genome has a certain number of nucleotides be inserted or deleted. InDel markers combine the characteristics of variants of Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphisms (SNPs), and are a type of codominant markers. As an important component part of Structure Variants (SVs), InDel markers are widely present in genomes, and the distribution density of InDel markers is second only to that of SNPs (one locus per 268 bp), with an InDel locus per 953 bp on average, which is much higher than that of SSRs. Compared with SNP markers, InDel markers are simpler to design and detect. At the same time, as a new type of codominant molecular markers, InDel markers have the advantages of various genetic markers, such as wide distribution in genomes, high density, high accuracy, stable variants, unique locus, and easy detection. At present, InDel markers have been applied to multiple aspects of important crops (including rice}, such as high- density molecular marker genetic map construction, gene mapping, genetic diversity analysis and hybrid progeny identification.
    Rice is an important food crop in China, and hybrid rice has made a great contribution to the food security of China and even the world with a significant yield advantage. The promotion and application of a new rice variety play an important role in ensuring food supply and meeting the diverse needs of the people. Rice has become a model plant for gramineous plants and monocots because of having a small genome, a complete genetic transformation system and a good commonality with other gramineous plants. At present, a large number of InDel markers have been developed based on the results of rice genome sequencing, but the development of rice InDel markers is still not saturated.
    Summary In view of the defects of the prior art, the present invention provides InDel molecular markers closely linked to rice heading date genes and application thereof.
    In view of the pivotal role of rice in food security and sustainable agricultural development, the development of new specific rice InDel markers is of great significance for the construction of high-density genetic maps and variety fingerprints.
    Chromosome segment substitution line CSSL41 is a BC4F4 population obtained by crossing between parents 9311 and Shengdao 16, back crossing between F1 generation and recurrent parent Shengdao 16 for four generations, and then selfing for four generations. The heading date of CSSL41 is around the 83th day, and that of Shengdao 16 is around the 112th day. CSSL41 is crossed with Shengdao 16, and F1 generation is selfed to obtain an F2 secondary segregation population (hereinafter referred to as F2 population). According to the statistics of field heading date survey results, the heading date distribution of 2184 effective individual plants of the F2 population shows an obvious bimodal trend. Taking the 113th day as the heading date dividing ling, the population is divided into an early heading population and a late heading population; the early heading population includes 1634 plants, and the late heading population includes 530 plants. x2=0.15<Po05=3.84. The segregation ratio of early heading and late heading in this population is basically in line with 3:1, indicating that the segregation of heading date is controlled by a pair of alleles, early heading is a dominant trait, and late heading is a recessive trait.
    About 600 random SSR markers on rice genomes are used to amplify the parents CSSL41 and Shengdao 16, markers with polymorphisms between the two parents are selected by polyacrylamide gel, and these markers are used to amplify the very early and very late heading plants. It is preliminarily determined that the chromosome 6 substitution segment RM527-RM541- PSM136 of the chromosome segment substitution line CSSL41 is related to the heading date.
    The present invention has the following technical solution: An InDel molecular marker IN2 closely linked to rice heading date genes has a nucleotide sequence of SEQ ID NO. 1; SEQ ID NO. 1: ACAAAATGCAG.
    Preferably according to the present invention, the molecular marker IN2 is located on rice chromosome 6, and is a nucleotide sequence of an insert.
    Preferably according to the present invention, the molecular marker IN2 is located at positions 10008107-10008117 on rice chromosome 8 of japonica variety Nipponbare, and is an insertion mutation in the genome sequence of japonica variety Nipponbare.
    The molecular marker IN2 has a forward primer sequence of SEQ ID NO. 2 and a reverse primer sequence of SEQ ID NO. 3; SEQ ID NO. 2: CAACAAGGGAAGAACAACAGA; SEQ ID NO. 3: TGGATGCTACCGCCAAGAAG.
    Preferably according to the present invention, the amplification region of a primer pair of the molecular marker IN2 is located at positions 10008072-10008239 on rice chromosome 6 of japonica variety Nipponbare, and has a sequence of SEQ ID NO. 4;
    SEQ ID NO. 4:CAACAAGGGAAGAACAACAGAGAGCCGAATAAACAACAAAATGCAGGCGTTAAGTTCAAGAGAAAGACTTAAGCAGAGAAAGCAACTGGATTTGGAAGACAAATTTATTTATTTAAGAGCTTC CTAATGTTAGATCTGTCCATATTAACTTCTTGGCGGTAGCATCCA.
    Application of the molecular marker IN2 in genetic analysis and fine mapping of rice heading date genes.
    Application of the primer pair of the molecular marker IN2 in genetic analysis and fine mapping of rice heading date genes.
    An InDel molecular marker IN10 closely linked to rice heading date genes has a nucleotide sequence of SEQ ID NO. 5; SEQ ID NO. 5: GGCTGATT.
    Preferably according to the present invention, the molecular marker IN10 is located on rice chromosome 6, and is a nucleotide sequence of an insert.
    Preferably according to the present invention, the molecular marker IN10 is located at positions 10027614-10027621 on rice chromosome 6 of japonica variety Nipponbare, and is an insertion mutation in the genome sequence of japonica variety Nipponbare.
    The molecular marker IN10 has a forward primer sequence of SEQ ID NO. 6 and a reverse primer sequence of SEQ ID NO. 7; SEQ ID NO.6: TTCTGTGGGTGTTGGGGGT,; SEQ ID NO.7: TGCTGCGTTTGCATTGCTC.
    Preferably according to the present invention, the amplification region of the primer pair of the molecular marker IN10 is located at positions 10027555-10027676 on rice chromosome 6 of japonica variety Nipponbare, and has a sequence of SEQ ID NO. 8.
    SEQ ID NO. 8:TTCTGTGGGTGTTGGGGGTGGAAATCCTGGGGGCTTCGCCGACAAGGACACGCCTGATTGGCTGATTTAGGAAACATCGCCGTCACCTGGCAGGCTGGCACCGGAGCAATGCAAACGCAG CA.
    Application of the molecular marker IN10 in genetic analysis and fine mapping of rice heading date genes.
    Application of the primer pair of the molecular marker IN10 in genetic analysis and fine mapping of rice heading date genes.
    Co-application of the molecular marker IN2 and the molecular marker IN10 in genetic analysis and fine mapping of rice heading date genes.
    Co-application of the primer pair of the molecular marker IN2 and the primer pair of the molecular marker IN10 in genetic analysis and fine mapping of rice heading date genes.
    Beneficial Effects of Technical Solution of the Present Invention
    1. The present invention provides InDel molecular markers IN2 and IN10 closely linked to rice heading date QTL for the first time, and provides a primer pair for amplifying the InDel molecular marker IN2 and a primer pair for amplifying the InDel molecular marker IN10; experiment proves that rice heading date gene Hd&{t) is located between the InDel molecular markers IN2 and IN10 on chromosome 6, with a physical distance of 19.3 kb.
    2. The genomic DNA of parents rice chromosome segment substitution line CSSL41 (hereinafter referred to as CSSL41) and Shengdao 16 as well as exchange plants of the parents is amplified by the primer pairs of the InDel molecular markers IN2 and IN10 involved in the present invention, and is detected by 6% polyacrylamide gel electrophoresis, the amplification products have obvious banding patterns and good polymorphisms among varieties; the InDel molecular markers IN2 and IN10 as well as the corresponding primer pairs involved in the present invention can be used for the genetic analysis and fine mapping of rice heading date genes, and can also be used for the construction of high-density genetic maps and variety fingerprints of rice. Description of Drawings Fig. 1 is a photo of results of parent polymorphism screening and polyacrylamide gel electrophoresis detection of rice SSR markers; in the figure: a is CSSL41, b is Shengdao 16, 1 is the results of parent polymorphism screening and polyacrylamide gel electrophoresis detection of PSM136, 2 is the results of parent polymorphism screening and polyacrylamide gel electrophoresis detection of RM541, and 3 is the results of parent polymorphism screening and polyacrylamide gel electrophoresis detection of RM3330.
    Fig. 2 is a photo of results of polyacrylamide gel electrophoresis detection of rice SSR markers PSM388 and RM527 amplification parents and late heading individuals in the Fz population; In the figure: A is the results of genotype detection of CSSL41, Shengdao 16 and late heading individuals in the F: population amplified by the primer pair of PSM388, 1-20 are individuals in the F2 population, P1 is CSSL41, and P- is Shengdao 16; and B is the results of genotype detection of CSSL41, Shengdao 18 and late heading individuals in the Fz population amplified by the primer pair of RM527, 1-20 are individuals in the F: population, P1 is CSSL41, and P2 is Shengdao 16.
    Fig. 3 is a photo of results of polyacrylamide gel electrophoresis detection of rice SSR markers Ha30 and Ha36 amplification parents and exchange plants in the F2 population; in the figure: A is the results of genotype detection of CSSL41, Shengdao 16 and exchange plants in the F2 population amplified by the primer pair of Ha30, A1-A24 are exchange plants in the F2 population detected by both border primers of PSM388 and RM527, P1 is CSSL41, and P2is Shengdao 16; B is the results of genotype detection of CSSL41, Shengdao 16 and exchange plants in the F. population amplified by the primer pair of Ha36, A1-A24 are exchange plants in the F:
    population detected by both border primers of PSM388 and RM527, P1 is CSSL41, and P2 is Shengdao 16; Fig. 4 is a photo of results of polyacrylamide gel electrophoresis detection of rice InDel molecular markers IN2 and IN10 amplification parents and exchange plants in the F2 population; 5 A is the results of genotype detection of CSSL41, Shengdao 16 and exchange plants in the Fz population amplified by the primer pair of IN2, A1-A24 are exchange plants in the F2 population detected by both border primers of PSM388 and RM527, P1 is CSSL41, and P2 is Shengdao 16; B is the results of genotype detection of CSSL41, Shengdao 16 and exchange plants in the F2 population amplified by the primer pair of IN10, A1-A24 are exchange plants in the F2 population detected by both border primers of PSM388 and RM527, P1 is CSSL41, and P2 is Shengdao 16; Fig. 5 is a molecular linkage map of heading date genes on rice chromosome 86. Detailed Description The technical solution of present invention is further described below in combination with embodiments. However, the protection scope of the present invention is not limited thereto. Source of Biomaterials Chromosome segment substitution line CSSL41 is constructed by a laboratory, and the construction method is that a BC4F4 population is obtained by crossing between parents 9311 and Shengdao 16, back crossing between F1 generation and recurrent parent Shengdao 16 for four generations, and then selfing for four generations. The statistics of heading date survey results show that the heading date of CSSL41 is 27-34 days earlier than that of Shengdao 16. Shengdao 16 is constructed by the Rice Research Institute of Shandong Academy of Agricultural Sciences (Chen Feng et al., Breeding and Cultivation Technology of New Rice Variety Shengdao 18, Shandong Agricultural Sciences, 2009, 10:107-108). The enzymes, molecular reagents, kits, etc. involved in the technical solution of the present invention are all ordinary commercial products. The primers involved in the embodiments are synthesized by Sangon Biotech (Shanghai) Co., Ltd. Microsyringe: a common commercial product, purchased from Shanghai Medical Laser Instrument Factory. Embodiment 1 Design of Detection Primers for InDel Molecular Markers Closely Linked to Rice Heading Date QTL
    1.1 Primer Design Method Molecular markers are designed based on the genome sequencing results of japonica rice (Nipponbare} and indica rice (9311) in a chromosome segment that need to develop InDel markers. The sequences of Nipponbare PAC/BAC clones in this region are downloaded from the website of TIGR (The Institute of Genome Research) (http://www. tigr.org/tdb/rice). Desired
    PAC/BAC clones are selected, and each clone is divided into continuous 2 kb segments. Then, these 2 kb sequences are compared with the sequences of indica variety 9311, and the sequences with an inserted/deleted base number of 7-12 bp are screened out as candidate sequences. Primers are designed within 200 bp on each flank of the screened InDel loci based on the genome sequence of Nipponbare. The primers are designed by Primer3plus {http://www bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and follows the following rules: primer length is 18-25 bp, product length is between 150-350 bp, GC content is about 50%, annealing temperature is about 55°C, and no mismatch, dimer or hairpin structure exists.
    A physical map of molecular markers is constructed by a direct physical mapping method based on the pseudomolecules of Nipponbare published by IRGSP, i.e., molecular markers with polymorphisms between two parents are directly marked. The specific method is as follows: BLAST search is performed on the genome sequence of Nipponbare for the amplification primer sequence of each molecular marker to learn the specific position of each molecular marker on the chromosome.
    Based on the results of molecular marker analysis, individuals with parental banding patterns of CSSL41 and Shengdao 16 are respectively recorded as 1 and 3, and individuals with biparental banding patterns (heterozygous banding patterns) are recorded as 2. Linkage analysis on the heading date phenotype data and the banding pattern marker segregation data of the mapping population is performed by a MAPMAKER/EXP. Version 3.0 software based on the results of banding pattern analysis, and a recombination rate is converted into a genetic distance (centimorgan, cM) by Kosambi's function to construct a physical linkage map of the target genes. Similarly, the physical location of a clone where a new primer is located is determined and integrated into a genetic map, and the physical location between two markers is calculated.
    2.2 Application of Primers of Rice SSR Molecular Marker and InDel Molecular Marker in Fine Mapping of Rice Heading Date Gene Hd6(t) Polymorphic screening is performed by the published SSR primers, and rice heading date genes are located in the region between the two markers RM527 and PSM388 on rice chromosome 6 (see Fig. 2). The details are as follows: Polymorphic screening is performed between the substitution line CSSL41 and Shengdao 16 based on the published SSR primers as shown in Table 1, and it is found that a total of five SSR primers including RM527, PSM388, RM541, PSM136 and RM3330 have polymorphisms between the two parents (see Fig. 1 and Fig. 2).
    Molecular data is analyzed by a MAPMAKER (EXP3.0b) software based on the results of molecular marker analysis, and the genetic distance between markers is calculated. The heading date gene HdB(t) is located on chromosome 6, the genetic distance from the microsatellite marker RM527 to Hd6(t) on one side of the heading date QTL is 1.0 cM, and the genetic distances from the microsatellite markers PSM388, RM541 and PSM136 to Hd6(t) on the other side are respectively 5.2 cM, 11.2 cM and 16.5 cM, as shown in Fig. 5.
    Table 1 SSR Markers on Single Segment Substitution Line © Primer Primer Sequence 5-3 Polymorphism RM557F gTggCgAgATCTATgTggTg RM557R gCTTTgTgTgTgTgTgTgTg ) RM539F GGTCATGCATGGATGGAATATGG RM539R GGTTGTAGGGCAGGACGGATAGG ) RM136F CATATGCACGAACTCACCTTTGC RM136R GCTGCTGCCTCTAGCTTACTTGG * RM527F CGGTTTGTACGTAAGTAGCATCAGG RM527R TCCAATGCCAACAGCTATACTCG * RM5850F TTATACACAGATGACGCACACG RM5850R TGGGTTAAGGGACACACTTAGG ) RM3330F ATTATTCCCCTCTTCCGCTC RM3330R AAGAAACCCTCGGATTCCTG * PSM388F AgCAAgCTCCTCCTATTCATC PSM388R TTgTCTCCTCCCATCTTATCC * RM1161F CTTTGCAAACTTGCCATCCAATCC RM1161R ~~ GATGGGCAAGGAGGCTGGTAGC ) RM3F ACACTGTAGCGGCCACTG RM3R CCTCCACTGCTCCACATCTT ) RM541F TATAACCGACCTCAGTGCCC RM541R CCTTACTCCCATGCCATGAG * F means a forward primer, and R means a reverse primer.
    RM527 and PSM388 are used as border markers, and all the individual plants with recessive traits (late heading) in the F2 secondary segregation population are screened to obtain 24 exchange plants, named A1-A24.
    In order to further locate the target genes, a microsatellite sequence is found based on the BAC sequence between RM527 and PSM388, and new SSR marker primers are designed, as shown in Table 2; recombinant plants are amplified, wherein Ha2, Ha15, Ha30, Ha36 and Hat have polymorphisms between the two parents; the five pairs of primers are used to amplify the recombinant plants between RM527 and PSM388, wherein the results of electrophoresis detection of rice SSR marker Ha30 and Ha36 amplification are shown in Fig. 3; genotypes and phenotypes are analyzed, and the heading date gene Hd6(t) is located between Ha30 and Ha36, with a physical distance of 121 kb, as shown in Fig. 5.
    Table 2 Primer Primer Sequence 5-3 Polymorphism Hal5F CAACCATCTCAAGCGCCAACA Hal5R TCGCCAGTCCATATTTCCAAC * Ha26F CGAATGCGGGCACGAT Ha26R ACCTGTCATCCCCAACCC ) Ha27F GGTTGGGGATGACAGGTG Ha27R TTTTAGTGGAATTTTCAGAG ) Ha30F TATCTCTTTCTTCTCCACCTCCG Ha30R ACTGCTCCTTGCTTCATTCTG Ha36F GGAGGTCGAACCCGTCCT Ha36R ATCCCCGCCATCCAAAAC Hal8F GGTCGAACCCGTCCTACT HalsR GAACGAAACTACCCTATCCC ) Hal3F CCCGTGAGATGGGCTACCTACA , Hal3R CCTTCACAGCGAACGTGGTG HalF GCAGAACACTGGCAACCT HalR GACTCCCGATCCACAAGG ) Ha2F CAGAACACTGGCAACCTA A Ha2R GAATTTTCCCCGATTTTA F means a forward primer, and R means a reverse primer.
    In order to further conduct fine mapping of the target genes, it is necessary to further develop markers with polymorphisms between Ha30 and Ha36; since no SSR markers with relatively good polymorphisms exist between Ha30 and Ha36, seven pairs of InDel markers are developed in the region between Ha30 and Ha36 markers based on the genome sequence of Nipponbare, and the primers of the seven pairs of InDel molecular markers are shown in Table 3. The developed InDel markers are used to select markers with polymorphisms, i.e.
    IN1, IN2, IN10 and IN7. The rest recombinant plants between Ha30 and Ha36 are further analyzed.
    Exchange plant A9 has a heterozygous band at the molecular markers IN1 and IN2, so it can be known that the target genes are on the right side of the molecular markers IN1 and IN2; exchange plants A18 and A24 are heterozygous at the molecular markers IN10 and IN7, so it can be known that the target genes are on the left side of the molecular markers IN10 and IN7. It is proved that the target gene Hd6(t) is between the markers IN2 and IN10, with a physical distance of 19.315 KB.
    The InDel molecular marker IN2 is located at positions 10008107-10008117 on rice chromosome 6 of japonica variety Nipponbare, and the nucleotide sequence of the insert is SEQ ID NO. 1: ACAAAATGCAG.
    The molecular marker IN10 is located at positions 10027614-10027621 on rice chromosome 6 of japonica variety Nipponbare, and the nucleotide sequence of the insert is SEQ ID NO. 5: GGCTGATT.
    The InDel molecular marker IN2 has a forward primer sequence of SEQ ID NO. 2 (i.e. IN2F) and a reverse primer sequence of SEQ ID NO. 3 (i.e. IN2R}; and the InDel molecular marker IN10 has a forward primer sequence of SEQ ID NO. 6 (i.e. IN10F) and a reverse primer sequence of SEQ ID NO. 7 (i.e. IN10R), as shown in Table 3.
    The amplification region of the primer pair of the molecular marker IN2 is located at positions 10008072-10008239 on rice chromosome 6 of japonica variety Nipponbare, and has a sequence of SEQ ID NO. 4.
    SEQ ID NO. 4:CAACAAGGGAAGAACAACAGAGAGCCGAATAAACAACAAAATGCAGGCGTTAAGTTCAAGAGAAAGACTTAAGCAGAGAAAGCAACTGGATTTGGAAGACAAATTTATTTATTTAAGAGCTTC CTAATGTTAGATCTGTCCATATTAACTTCTTGGCGGTAGCATCCA.
    The amplification region of the primer pair of the molecular marker IN10 is located at positions 10027555-10027676 on rice chromosome 86 of japonica variety Nipponbare, and has a sequence of SEQ ID NO. 8.
    SEQ ID NO. 8:TTCTGTGGGTGTTGGGGGTGGAAATCCTGGGGGCTTCGCCGACAAGGACACGCCTGATTGGCTGATTTAGGAAACATCGCCGTCACCTGGCAGGCTGGCACCGGAGCAATGCAAACGCAG CA.
    Table 3 Primer Primer Sequence 5-3 Polymorphism INTF GGGGTGAAGATTTCTGGTATT ,
    INTR GCAATCGGATTATGATTTGG IN2F CAACAAGGGAAGAACAACAGA , IN2R TGGATGCTACCGCCAAGAAG IN3F GTATGCCTGCGGAGTGGA IN3R TGTCCCTGCCAACATCGT ) IN4F TGTGGCTGGATAATGGGATTG IN4R GGAAGCAGGTGATGATGACT )
    INSF CGCAGTCCATCCAACCCA IN5R AAGCCAATGCCAAGAACA ) IN7F TGCTGTGTTCAGATAAAGGGGT A IN7R ATGATTTGACAATGTGGTGC IN1OF TTCTGTGGGTGTTGGGGGT AINTOR TGCTGCGTTTGCATTGCTC
    F means a forward primer, and R means a reverse primer. Embodiment 2 Application of Primers of InDel Molecular Markers IN2 and IN10 in Rice Genes
    2.1 Extraction of Rice Genomic DNA For CSSL41 and Shengdao 16, RM527 and PSM388 are used as border markers, and all the individual plants with recessive traits {late heading) of F2 generation are screened to obtain 24 exchange plants (A1-A24). Rice total genomic DNA is extracted by a modified TPS simple method, and the specific steps are as follows:
    2.1.1 Taking 1-2 young leaves from the upper part of each individual plant in peak tillering stage, and storing the leaves in a refrigerator at -80°C for later use;
    2.1.2 To extract DNA, putting a rice leaf with a length of 2-4 cm in a 1.5 ml centrifuge tube, adding liquid nitrogen, grinding, adding 900 ml of TPS extract, and keeping in a water bath at 75°C for 30-60 min;
    2.1.3 Centrifuging at 12,000 rpm for 10 min, transferring 500 ml of supernatant to a new 1.5 ml centrifuge tube;
    2.1.4 Adding pre-cooled isopropanol or absolute ethanol to top up, keeping overnight at 4°C, and centrifuging at 12,000 rpm for 10 min; and
    2.1.5 Discarding the supernatant, drying the precipitate, adding 150 pl of sterile water, and storing at 4°C for later use. The components of the TPS extract are as follows: 100 mM of Tris-HCL (pH 8.0), 10 mM of EDTA (pH 8.0), and 1 M of KCL.
    2.2 PCR Amplification PCR amplification is carried out in a PE9700 thermal cycler, and the components of a 20 pl reaction system are as follows: 2x10 pl of Hifi PCR Mix, 1 ul of 50-100 ng DNA template, 1 ul of the forward primer, 1 ul of the reverse primer, 1 yl of ddH207, and 20 pl of overall reaction system. Primers of InDel molecular markers IN2 and IN10 are used. The PCR reaction procedure is: Pre-denaturing at 94°C for 5 min; denaturing at 94°C for 1 min, annealing at 55°C for 1 min, and extending at 72°C for 1 min which are cycled for 35 times; and extending at 72°C for 5 min.
    2.3 Polyacrylamide Gel Electrophoresis Segregation and Polymorphism Detection PCR products are subject to electrophoresis by 6% polyacrylamide gel, and the basic operation comprises the following three steps: Gel Preparation: weighing 9.6 g of urea, adding 45 ml of distilled water and 8 ml of 10xTBE buffer, stirring with a glass rod to completely dissolve the urea, adding 12 ml of 40% acrylamide solution, stirring well, adding 0.8 ml of 10% ammonium persulfate and 35 ul of TEMED, pouring the mixture into a glass plate sealed with agarose gel immediately after stirred well, laying the glass plate flat after fully filled, and keeping the glass plate at an inclination angle of about 10° with respect to the desktop. Inserting a comb, and standing for 1-2 h to solidify the gel.
    The components of the 10x TBE buffer are as follows: 108 g of Tris-HCI, 55 g of boric acid, and 7.44 g of EDTA which are dissolved by distilled water and diluted to 1000 ml; The components of the 40wt% acrylamide solution are as follows: 38 g of acrylamide, and 2 g of N,N'-methylene bisacrylamide which are added with water and diluted to 100 ml; Sample Application: after the gel is completely solidified, carefully pulling out the comb and keeping sample application holes intact as far as possible. Fixing the glass plate on a vertical electrophoresis tank, and adding an appropriate amount of 1x TBE electrophoresis buffer; rinsing the sample application holes repeatedly with the electrophoresis buffer to remove excess unset substances; taking the PCR amplification products, adding 4 pl of loading buffer to each tube of PCR products, mixing well, and injecting 3-4 pl of the mixture into the sample application holes.
    The components of the loading buffer are as follows by weight percentage:
    0.25% of bromophenol blue, 0.25% of xylene cyanogen, 50% of glycerine, and the balance of water.
    Electrophoresis: adjusting the voltage to 250 V, and conducting electrophoresis for about 3- 4h.
    After the electrophoresis is completed, removing the glass plate from the electrophoresis tank, taking out the gel, and rinsing twice in distilled water; transferring the gel to a 0.1wt% AgNO; solution for staining, and shaking gently on a shaking table for 10 min; then transferring the gel to distilled water and rinsing twice; and finally, transferring the gel to a coloration solution for coloration, transferring the gel to tap water for storage after staining, and recording the banding pattern results or gel imaging (see Fig. 4).
    The components of the coloration solution are as follows: 6 g of sodium hydroxide, 0.076 g of sodium borate, and 1.6 ml of formaldehyde which are added with water and diluted to 400 ml.
    It can be seen from Fig. 4 of the above experimental results that the amplification products of the primers of the InDel molecular markers IN2 and IN10 in rice genes have obvious banding patterns and good polymorphisms among varieties. The primers of the InDel molecular markers IN2 and IN10 designed by the present invention are used to amplify the F2 secondary segregation population, and the dominant heading date gene is located between the InDel molecular markers IN2 and IN10 on rice chromosome 6, with a physical distance of 19.3 kb. Gene prediction and functional analysis of the 19.3 kb chromosome region between IN2 and IN10 are carried out through a Rice Genome Automated Annotation System (RiceGAAS), and three ORFs (Open Reading Frames) are found in the region, among which ORF 1 belongs to a Protein Kinase (PK)
    and has a serine-threonine/tyrosine protein kinase catalytic domain; ORF2 contains a Phosphatidylinositol 3-/4-Kinase (PI3K/PI4K) catalytic domain and belongs to a Phosphatidylinositol Kinase (PIK); and ORF3 is a short peptide with unknown functions.
    The primers of the InDel molecular markers IN2 and IN10 designed by the present invention are used for the genetic analysis and fine mapping of rice heading date genes, and can also be used for the construction of high-density genetic maps and variety fingerprints of rice.
    The co-application of IN2 and IN10 will make it possible to locate the target QTL in the region between IN2 and IN10, and improve the accuracy of fine mapping.
    SEQUENCE LISTING <110> Shandong Academy of Agricultural Sciences, Biotechnology Research Center <120> InDel MOLECULAR MARKERS CLOSELY LINKED TO RICE HEADING DATE GENES
    AND APPLICATION THEREOF <130> BJS-RHD Markers NL <150> CN 202010280591.8 <151> 2020-04-10 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> Marker <400> 1 acaaaatgca g 11 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer <400> 2 caacaaggga agaacaacag a 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer <400> 3 tggatgctac cgccaagaag 20 <210> 4 <211> 168 <212> DNA <213> Artificial Sequence <220> <223> Amplification Region <400> 4 caacaaggga agaacaacag agagccgaat aaacaacaaa atgcaggcgt taagttcaag 60 agaaagactt aagcagagaa agcaactgga tttggaagac aaatttattt atttaagagc 120 ttcctaatgt tagatctgtc catattaact tcttggcggt agcatcca 168 <210> 5
    <211> 8
    <212> DNA
    <213> Artificial Sequence
    <220>
    <223> Marker
    <400> 5 ggctgatt 8 <210> 6
    <211> 19
    <212> DNA
    <213> Artificial Sequence
    <220>
    <223> Forward Primer
    <400> 6 ttctgtgggt gttgggggt 19 <210> 7
    <211> 19
    <212> DNA
    <213> Artificial Sequence
    <220>
    <223> Reverse Primer
    <400> 7 tgctgcgttt gcattgctc 19 <210> 8
    <211> 122
    <212> DNA
    <213> Artificial Sequence
    <220>
    <223> Amplification Region
    <400> 8 ttctgtgggt gttgggggtg gaaatcctgg gggcttcgcc gacaaggaca cgcctgattg 60 gctgatttag gaaacatcgc cgtcacctgg caggctggca ccggagcaat gcaaacgcag 120 ca 122
    权利要求:
    Claims (10)
    [1]
    An InDel molecular marker IN2 closely associated with the date genes for rice heading, wherein the molecular marker IN2 has a nucleotide sequence of SEQ ID NO1.
    [2]
    The InDel molecular marker IN2 according to claim 1, wherein the molecular marker IN2 is located on rice chromosome 6, and is a nucleotide sequence of an inserted fragment, wherein the molecular marker IN2 is preferably located at the positions 10008107-10008117 on rice chromosome 6 of the japonica variety Nipponbare and is an insertion mutation in the genome sequence of the japonica variety Nipponbare.
    [3]
    An amplification primer pair of the InDel molecular marker IN2 according to claim 1, wherein the amplification primer pair of the molecular marker IN2 is a forward primer sequence according to SEQ ID NO. 2 and a reverse primer sequence according to SEQ ID NO. 3, wherein the amplification region of the primer pair of the molecular marker IN2 is preferably located at positions 10008072-10008239 on rice chromosome 6 of japonica variety Nipponbare, and a sequence according to SEQ ID NO. 4 has.
    [4]
    Use of the InDel molecular marker IN2 according to claim 1 in the genetic analysis and sophisticated mapping of the date genes for rice heading.
    [5]
    Use of the amplification primer pair of the InDel molecular marker IN2 according to claim 3 in genetic analysis and sophisticated mapping of the date genes for rice heading.
    [6]
    An InDel molecular marker IN10 closely associated with the date genes for rice heading, wherein the molecular marker IN10 has a nucleotide sequence of SEQ ID NO5.
    [7]
    The InDel molecular marker IN2 according to claim 6, wherein the molecular marker IN2 is located on rice chromosome 6, and is a nucleotide sequence of an inserted fragment, wherein the molecular marker IN10 is preferably located at positions 10027614-10027621 on rice chromosome 6 of japonica variety Nipponbare and is an insertion mutation in the genome sequence of the japonica variety Nipponbare.
    [8]
    An amplification primer pair of the InDel molecular marker IN10 according to claim 6, wherein the amplification primer pair of the molecular marker IN10 is a forward primer sequence according to SEQ ID NO. 6 and a reverse primer sequence according to SEQ ID NO. 7, wherein the amplification region of the primer pair of the molecular marker IN10 is preferably located at positions 1002/555-100276/6 on rice chromosome 6 of japonica variety Nipponbare, and a sequence according to SEQ ID NO. 8 has.
    [9]
    Use of the InDel molecular marker IN10 according to claim 6 in the genetic analysis and sophisticated mapping of the date genes for rice heading, preferably the use of the amplification primer pair of the InDel molecular marker IN10 according to claim 8 in the genetic analysis and sophisticated mapping of the date genes for rice heads.
    [10]
    The joint use of the molecular marker IN2 according to claim 1 and the molecular marker IN10 according to claim 6 in genetic analysis and the sophisticated mapping of the date genes for rice heading, preferably the joint use of the amplification primer pair of the InDel molecular marker IN2 according to claim 3 and the amplification primer pair of the InDel molecular marker IN10 according to claim 8 in the genetic analysis and sophisticated mapping of the date genes for rice heading.
    类似技术:
    公开号 | 公开日 | 专利标题
    Cui et al.2017|Utilization of a Wheat660K SNP array-derived high-density genetic map for high-resolution mapping of a major QTL for kernel number
    Sicard et al.2014|Repeated evolutionary changes of leaf morphology caused by mutations to a homeobox gene
    Liu et al.2008|Toward positional cloning of Fhb1, a major QTL for Fusarium head blight resistance in wheat
    Kirigwi et al.2007|Markers associated with a QTL for grain yield in wheat under drought
    Rahmatov et al.2016|A new 2DS· 2RL Robertsonian translocation transfers stem rust resistance gene Sr59 into wheat
    Yang et al.2013|Rapid development of molecular markers by next-generation sequencing linked to a gene conferring phomopsis stem blight disease resistance for marker-assisted selection in lupin | breeding
    Kumar et al.2012|Physical mapping resources for large plant genomes: radiation hybrids for wheat D-genome progenitor Aegilops tauschii
    An et al.2019|Development and molecular cytogenetic identification of a new wheat-rye 4R chromosome disomic addition line with resistances to powdery mildew, stripe rust and sharp eyespot
    US10301687B2|2019-05-28|Sidt 1 gene controlling determinate growth habit in sesame and SNP molecular marker thereof
    Wang et al.2015|Origin of worldwide cultivated barley revealed by NAM-1 gene and grain protein content
    Pavan et al.2008|Map-vs. homology-based cloning for the recessive gene ol-2 conferring resistance to tomato powdery mildew
    Bie et al.2015|Development and characterization of marker MBH1 simultaneously tagging genes Pm21 and PmV conferring resistance to powdery mildew in wheat
    Fiust et al.2015|Development of DArT-based PCR markers for selecting drought-tolerant spring barley
    Singh et al.2016|Genetics of Fusarium wilt resistance in pigeonpea | and efficacy of associated SSR markers
    Goodwin et al.2015|A new map location of gene Stb3 for resistance to Septoria tritici blotch in wheat
    Zhao et al.2019|Comparative analysis of genetic effects of wheat‐Dasypyrum villosum translocations T6V# 2S· 6AL and T6V# 4S· 6DL
    Hossain et al.2019|High density linkage map construction and QTL mapping for runner production in allo-octoploid strawberry Fragaria× ananassa based on ddRAD-seq derived SNPs
    Said et al.2019|Uncovering homeologous relationships between tetraploid Agropyron cristatum and bread wheat genomes using COS markers
    CN106755480B|2020-07-17|SSR molecular marker I for identifying progeny plants of Gala apples and application thereof
    Lawton‐Rauh et al.2003|Patterns of nucleotide variation in homoeologous regulatory genes in the allotetraploid Hawaiian silversword alliance |
    Farré et al.2012|Genetic characterization of a reciprocal translocation present in a widely grown barley variety
    Türkösi et al.2016|Addition of Manas barley chromosome arms to the hexaploid wheat genome
    Yang et al.2018|High-density genetic map construction and mapping of the homologous transformation sterility gene | in wheat using GBS markers
    NL2026532A|2021-10-25|InDel MOLECULAR MARKERS CLOSELY LINKED TO RICE HEADING DATE GENES AND APPLICATION THEREOF
    KR20130091434A|2013-08-19|Primer for selecting variety resistant to rice stripe disease containing stv-bi gene and the selecting method thereof
    同族专利:
    公开号 | 公开日
    CN111304355A|2020-06-19|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    CN202010280591.8A|CN111304355A|2020-04-10|2020-04-10|InDel molecular marker closely linked with rice heading stage gene and application|
    [返回顶部]